The real-time qPCR method here developed was applied for the quantitative detection of GRLDaV in two mealybugs species, Planococcus citri and Pseudococcus viburni. Nine replicates of pools of 2 and 4, as well as individual mealybugs, fed on GRLDaV infected fresh leaves, were analyzed. GRLDaV was successfully detected in all samples, including single mealybugs. No signal was detected for insects fed on healthy grapevine leaves. Viral titers quantified, as well as the mean viral titers for both pools and singles mealybugs and standard deviations, are shown in Supplementary Table S1. Under our experimental conditions, the viral titer determined in P. citri in single mealybugs ranged from 99 to 668 viral copies, with a mean viral titer of 321.76 ± 201.97. Viral quantification in mealybugs pools ranged from 128 to 1300 copies (for 2 insect pools) and from 234 to 1325 copies (for 4 insect pools), with a mean viral titer of 651.11 ± 345.59 and 987.33 ± 233.93 copies, respectively (325.55 ± 172.79 and 246.83 ± 108.91 copies per mealybug). For P. viburni the mean viral titer in single mealybugs was 136.53 ± 45.61 (from 54 to 192). Quantification on insect pools ranged from 271 to 691 (2 insect pools) and from 179 to 659 (4 insect pools), which represents a mean viral titer of 466.66 ± 155.49 and 506.11 ± 194.10, respectively (233.22 ± 77.74 and 126.53 ± 48.52 per mealybug). GRLDaV acquisition and detection experiments with P. citri and P. viburni showed the ability of these two mealybug species to carry GRLDaV, and the performance of the real-time qPCR developed in this study to detect and quantify GRLDaV in putative mealybugs.

A total of 22 GRLDaV infected grapevine samples from different origins and varieties were selected as positive controls for this study: 17 samples from Greece (cv. Roditis, Dafnia, Mavrothiriko, Moschato Samou, Korinthiaki stafida, Romeiko, Lagorthi, Assyrtiko, and Koumariano); 2 samples from Turkey (cv. Yalova incisi) kindly supplied by Dr. Ulubaş Serçe (Niğde Ömer Halisdemir University); 2 samples from Italy (cv. Bombino Nero) kindly supplied by Dr. Minafra (CNR-IPSP); and 1 sample from Croatia (cv. Ljutun) kindly supplied by Dr. Vončina (University of Zagreb). The presence of GRLDaV in all positive samples was confirmed by PCR using two different sets of primers. Badna-R-Up (5′GAAGGAATTGAATCTCCAGCAGCAGG3′, sense) and Badna-R-Do (5′CTCTGCTACACCAAGTGATAGATTGTTGAG3′, antisense) [4] and Badna-FP (5′ATGCCITTYGGIAARAAYGCICC3′, sense) and Badna-RP (5′CCAYTTRCAIACISCICCCCAICC3′, antisense) [16]. Plant material from grapevines (cv. Bobal, Tempranillo, Marsaoui, Razzegui, Red Globe, and Crimson seedless) analyzed by high throughput sequencing (HTS), harboring different non targeted viruses, and from Spanish grapevine cultivars (cv. Aledo and Ideal) sanitized by tip culture was used as negative control and for specificity assays. In addition, 65 grapevine samples randomly collected from two Greek grapevine growing areas (Athens and Pieria) were analyzed.

Leaf tissue from each plant sample was placed in individual plastic bags (Bioreba, Reinach, Switzerland). Extraction buffer (PBS containing 0.2% diethyldithiocarbamate and 2% PVP-10) was added up to a 1:5 ratio (w:v). Homex 6 homogenizer (Bioreba, Reinach, Switzerland) was used for grinding. For crude extract qPCR real-time analysis, 1:50 plant extract dilutions were performed in H₂O, centrifuged at 20,000× g for 1 min, heated at 95 °C for 10 min, and placed on ice. DNA was purified from 200 µL of the same plant extracts using a Plant/Fungi DNA isolation kit (Norgen Biotek Corporation, Thorold, ON, Canada) following the manufacturer’s instructions. Extracted DNA was quantified with a DeNovix DS-11 spectrophotometer (DeNovix Inc., Wilmington, DE, USA) to determine the DNA concentrations and stored at −80 °C until subsequent analysis.

Total DNA was extracted from mealybugs using a Plant/Fungi Total DNA Purification Kit (Norgen Biotek Corporation, Thorold, ON, Canada) with slight modifications. Briefly, 400 μL of PBS 1X buffer was added to tubes containing 1, 2, 4, or 5 mealybugs. The suspension was vortexed for 5 min in the presence of 212–300 μm glass beads (Sigma-Aldrich, St. Louis, MO, USA). After centrifugation at 10,000× g for 5 min, 200 µL of the clarified supernatant was transferred to a fresh tube, and the extraction procedure was completed following the manufacturer’s instructions.

Alignment of the three GRLDaV full genomes available in the databases [17] corresponding to isolates W4, BN, and VLJ-178 from Greece, Italy, and Croatia, respectively (accession numbers HG940503, KT965859, and MF991952) was performed using ClustalW implemented in Geneious software 10.0.7 (Biomatters Ltd., Auckland, New Zealand). Based on this alignment, primers targeting a 775 nt in the GRLDaV genome including part of the RNaseH sequence (ORF3) and part of the ORF4 region, GRLDaV-RNaseH-F (5′AGCCCACTCTATGCYAARACAAG3′, sense), and GRLDaV-RNaseH-R (5′TGCTTTCTTTGCTGACTCAGCTTC3′, antisense) were designed manually. Primers and probe melting temperatures and secondary structures were analyzed using the online OligoAnalyzer Tool (Integrated DNA Technologies Inc., Coralville, IA, USA). A 775 bp fragment was amplified from nine selected GRLDaV positive samples from different origins: sample R5 (Crete, Greece); sample R7 (Crete, Greece); sample BAK-27 (Nemea, Peloponese, Greece); sample Koum (Tinos island, Greece); sample D2-1 (Grapevine Institute, Athens, Greece); sample E3-2 (Grapevine Institute, Athens, Greece); sample VLJ-178 (Kaštela, Croatia); sample 53 (Adana province, Turkey) and sample Mahmood (Adana Province, Turkey). PCR amplification was performed using Platinum Taq DNA polymerase (Thermo Fisher Scientific, Waltham, MA, USA) following the manufacturer’s instructions. The reaction mixture contained 0.5 µM of each primer, 0.75 µL of KB Extender, and 40 ng of DNA in a volume of 3 µL, in a total reaction volume of 25 µL. PCR protocol consisted of a first step at 94 °C for 2 min, followed by 35 cycles of amplification (30 s at 94 °C, 30 s at 55 °C, and 48 s at 72 °C). All PCR amplicons were cleaned using mi-PCR Purification Kit (Metabion International AG, Martinsried, Germany), and Sanger sequenced in both directions.

All amplified RNaseH/ORF4 sequences, as well as the corresponding genomic region of the GRLDaV full-length sequences available in the databases (HG940503, KT965859, and MF991952), were aligned using ClustalW implemented in MEGA X software [18]. Based on the alignment, a set of five primers and a probe were designed for the real-time PCR assay. Three forward primers and two reverse primers were designed to cover all the variability detected in the selected region, yielding an amplicon of 196 bp: GRLDaV-F1 (5′AGTTTCTTCAACAAGTCAGC3′, sense); GRLDaV-F2 (5′AGTTTCTTCAACAAATCAGC3′, sense); GRLDaV-F3 (5′AGCTTCTTCAACAAATCCG3′, sense); GRLDaV-R1 (5′TGATTGCTCRTTTAACTGG 3′, antisense); and GRLDaV-R2 (5′ GACTGTTCCTTCAGCTG 3′, antisense). A TaqMan probe, GRLDaV-P (5′-6-FAM-ATTAACAGTTTCTTTCTTACAGAATGGAA-BHQ1-ZNA4-3′) showed specificity towards all the sequences used in the study.

TaqMan qPCR was performed in three different real-time thermal cyclers: StepOne Plus thermal cycler (Applied Biosystems, Foster City, CA, USA); QuantStudio 3 real-time PCR system (Applied Biosystems, Foster City, CA, USA), and LightCycler 480 (Roche, Basel, Switzerland), using a Premix Ex Taq master mix for probe-based real-time PCR (Takara Bio Inc., Kusatsu, Japan) according to the manufacturer’s instructions. Five microliters containing 70 ng of DNA or 5 µL of crude extract were used as a template. The reaction mixture contained 250 nM of the probe and 0.35 µM of each of the primers in a total reaction volume of 20 µL. For reactions performed in the Applied Biosystems instruments, 0.4 µL of the ROX Reference Dye (50X) was added as a passive reference dye. PCR reaction consisted of an initial denaturation step at 95 °C for 2 min, followed by 45 cycles of amplification (15 s at 95 °C and 1 min at 60 °C). Data acquisition and analysis were performed using the corresponding software for each thermal cycler. The default threshold set by the machines was slightly adjusted above the noise to the linear part of the growth curve at its narrowest point, according to the manufacturer.

For the generation of real-time qPCR standard curves, the RNaseH fragment targeted by the qPCR was amplified by conventional PCR using primers GRLDaV-F2 and GRLDaV-R1. The 196 bp PCR product was purified using a PCR Purification Kit (Metabion International AG, Martinsried, Germany) following the manufacturer’s instructions, inserted in the pGEM-T Easy vector (Promega Corporation, Madison, OH, USA), and cloned into Escherichia coli XL1-Blue. Transformant colonies were selected by ampicillin resistance. Plasmid extraction was performed using the mi-Plasmid Miniprep Kit (Metabion International AG, Martinsried, Germany) following the manufacturer’s instructions and quantified with a DeNovix DS-11 spectrophotometer (DeNovix Inc., Wilmington, DE, USA). Plasmid DNA was quantified in picomoles applying the following mathematical formula: pmol of dsDNA = (μg of dsDNA × 10⁶)/(660 × Nbp) considering the average molecular weight of a pair of nucleotides (660 Da) and the number of base pairs of the plasmid carrying the GRLDaV partial genomic RNaseH sequence (Nbp). The Avogadro constant [19] was used to estimate the number of plasmid molecules (6.023 × 10²³ molecules/mol). Three replicates of serial dilutions from 3 × 10¹⁰ to 2 plasmid copies were prepared and used to generate the standard curve. The amplification efficiency of the calibration curve was calculated by the slope, according to the mathematical formula: amplification efficiency = [10 ^(−1/slope)]−1 [20].

The real-time qPCR method developed in this study was validated according to the EPPO guidelines [21]. Thus, analytical sensitivity (maximum dilution of DNA detected), analytical specificity (inclusivity, detection of variants/strains covering genetic diversity and different geographic origin; exclusivity, negative detection of relevant non-targets that might be present in the matrix), selectivity (evaluation of test performance using different cultivars), and repeatability and reproducibility (evaluation of the test performance consistency on different replicates by different operators and with different equipment) were evaluated.

Colonies of the P. citri and P. viburni mealybugs were kindly provided by Dr. Beitia (IVIA). Adult mealybugs were originally collected from persimmon fruits (Diospyros kaki L.) located in a persimmon growing area in Algemesí (Ribera del Xúquer, Valencia, Spain). Mealybug colonies were maintained in lemon fruits at 26 °C for 60 days. During this period, the absence of GRLDaV in the mealybugs was confirmed twice, every 30 days, by testing 5 pools of 5 mealybugs by both the conventional and the real-time GRLDaV PCR detection methods previously described [4,16] and by the real-time qPCR method developed in this study. GRLDaV-free mealybugs were transferred to both GRLDaV infected and healthy grapevine leaves. Acquisition was performed at 28 °C, 60% humidity and a 12/12 h light cycle for 48 h in a plant growth chamber (Sanyo MLR-350H). After this time, pools of 2 and 4 mealybugs, as well as individual insects, were analyzed by the real-time qPCR developed in this study. These experiments were performed in nine technical repeats.